Transcript: Mouse NM_008432.3

Mus musculus potassium channel, subfamily U, member 1 (Kcnu1), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Kcnu1 (16532)
Length:
3548
CDS:
34..3399

Additional Resources:

NCBI RefSeq record:
NM_008432.3
NBCI Gene record:
Kcnu1 (16532)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_008432.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000068330 CCCTCCAACATCCACTTTATT pLKO.1 2650 CDS 100% 15.000 10.500 N Kcnu1 n/a
2 TRCN0000068328 CGCTTCTATGTCAACAGAAAT pLKO.1 1983 CDS 100% 13.200 9.240 N Kcnu1 n/a
3 TRCN0000068331 CGCTTTCTTTAGCTTCTATTT pLKO.1 471 CDS 100% 13.200 9.240 N Kcnu1 n/a
4 TRCN0000068332 GCAGAGCTAAAGCTCGGATTT pLKO.1 1459 CDS 100% 10.800 7.560 N Kcnu1 n/a
5 TRCN0000068329 GCCTGATTCTAGCCAACCATT pLKO.1 1265 CDS 100% 4.950 3.465 N Kcnu1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_008432.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.