Transcript: Mouse NM_008437.1

Mus musculus napsin A aspartic peptidase (Napsa), mRNA.

Source:
NCBI, updated 2017-05-13
Taxon:
Mus musculus (mouse)
Gene:
Napsa (16541)
Length:
1479
CDS:
172..1431

Additional Resources:

NCBI RefSeq record:
NM_008437.1
NBCI Gene record:
Napsa (16541)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_008437.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000030508 GCTGGTTTCACCATCGCTTTA pLKO.1 503 CDS 100% 10.800 15.120 N Napsa n/a
2 TRCN0000030504 CGGGCCTTGAATAAAGCCATT pLKO.1 1045 CDS 100% 4.050 5.670 N Napsa n/a
3 TRCN0000030505 CGAGATGTCATTTCTTCAGTT pLKO.1 476 CDS 100% 4.950 3.960 N Napsa n/a
4 TRCN0000030506 CCTTGGACACAGAATCTTAAA pLKO.1 267 CDS 100% 13.200 9.240 N Napsa n/a
5 TRCN0000030507 CCTCCTCAGAATTTCACCGTT pLKO.1 415 CDS 100% 2.640 1.848 N Napsa n/a
6 TRCN0000166364 CACACACACACACACACACAA pLKO.1 21 5UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_008437.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.