Transcript: Mouse NM_008446.2

Mus musculus kinesin family member 4 (Kif4), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Kif4 (16571)
Length:
4712
CDS:
405..4100

Additional Resources:

NCBI RefSeq record:
NM_008446.2
NBCI Gene record:
Kif4 (16571)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_008446.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000090911 CCATCTCACAAGAAATATCTT pLKO.1 3422 CDS 100% 5.625 7.875 N Kif4 n/a
2 TRCN0000315529 CCATCTCACAAGAAATATCTT pLKO_005 3422 CDS 100% 5.625 7.875 N Kif4 n/a
3 TRCN0000090908 GCACTAATGACTTCAGTAGTT pLKO.1 4167 3UTR 100% 4.950 3.960 N Kif4 n/a
4 TRCN0000309069 GCACTAATGACTTCAGTAGTT pLKO_005 4167 3UTR 100% 4.950 3.960 N Kif4 n/a
5 TRCN0000090910 GCCATCAGAACCAGGACAATT pLKO.1 3763 CDS 100% 13.200 9.240 N Kif4 n/a
6 TRCN0000090909 CCTGGAGATATAAATGTGGAA pLKO.1 1527 CDS 100% 2.640 1.848 N Kif4 n/a
7 TRCN0000309067 CCTGGAGATATAAATGTGGAA pLKO_005 1527 CDS 100% 2.640 1.848 N Kif4 n/a
8 TRCN0000090912 GCTAAGAAGATGACTCAGAAT pLKO.1 2025 CDS 100% 4.950 2.970 N Kif4 n/a
9 TRCN0000309135 GCTAAGAAGATGACTCAGAAT pLKO_005 2025 CDS 100% 4.950 2.970 N Kif4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_008446.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.