Transcript: Mouse NM_008498.2

Mus musculus LIM homeobox protein 1 (Lhx1), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Lhx1 (16869)
Length:
2750
CDS:
1360..2580

Additional Resources:

NCBI RefSeq record:
NM_008498.2
NBCI Gene record:
Lhx1 (16869)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_008498.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000070524 CGTCCAGTGCTGTGAATGTAA pLKO.1 1443 CDS 100% 5.625 7.875 N Lhx1 n/a
2 TRCN0000070527 CCGTTTCCTCTTGAACGTGTT pLKO.1 1398 CDS 100% 4.050 5.670 N Lhx1 n/a
3 TRCN0000070525 GCTCTACATCATAGACGAGAA pLKO.1 1668 CDS 100% 4.050 5.670 N Lhx1 n/a
4 TRCN0000432844 TGGCCTCAACATGCGTGTTAT pLKO_005 2010 CDS 100% 13.200 10.560 N Lhx1 n/a
5 TRCN0000070523 CGAGAACAAGTTCGTTTGTAA pLKO.1 1683 CDS 100% 5.625 4.500 N Lhx1 n/a
6 TRCN0000433923 GAGCGCGAAGCAAAGTGTTTC pLKO_005 1592 CDS 100% 10.800 7.560 N Lhx1 n/a
7 TRCN0000015016 GTGCTGTGAATGTAAATGCAA pLKO.1 1449 CDS 100% 3.000 2.100 N LHX1 n/a
8 TRCN0000070526 GCAGCGATTTACTGACATCCT pLKO.1 2379 CDS 100% 2.640 1.848 N Lhx1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_008498.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.