Transcript: Mouse NM_008598.2

Mus musculus O-6-methylguanine-DNA methyltransferase (Mgmt), mRNA.

Source:
NCBI, updated 2017-06-11
Taxon:
Mus musculus (mouse)
Gene:
Mgmt (17314)
Length:
857
CDS:
90..725

Additional Resources:

NCBI RefSeq record:
NM_008598.2
NBCI Gene record:
Mgmt (17314)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_008598.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000436311 TGAGCCGTCTGGCCGAAATTG pLKO_005 704 CDS 100% 4.400 6.160 N Mgmt n/a
2 TRCN0000039087 CTGGAAGCCTATTTCCGTGAA pLKO.1 297 CDS 100% 4.050 5.670 N Mgmt n/a
3 TRCN0000415155 TGACGGTGCCATCGGCCATTA pLKO_005 554 CDS 100% 3.600 5.040 N Mgmt n/a
4 TRCN0000022367 TTACCAGCAATTAGCAGCCCT pLKO.1 440 CDS 100% 0.660 0.924 N MGMT n/a
5 TRCN0000428115 GTGTTCCAGCAAGATTCATTC pLKO_005 363 CDS 100% 10.800 8.640 N Mgmt n/a
6 TRCN0000039086 ACGGTTTCTTACCAGCAATTA pLKO.1 432 CDS 100% 13.200 9.240 N Mgmt n/a
7 TRCN0000039085 GCTGCTGAAGGTTGTGAAATT pLKO.1 404 CDS 100% 13.200 9.240 N Mgmt n/a
8 TRCN0000436919 CAGTAGGAGGAGCAATGAGAA pLKO_005 487 CDS 100% 4.950 3.465 N Mgmt n/a
9 TRCN0000039088 GTAACCGTTTGAATGACACAT pLKO.1 726 CDS 100% 4.950 3.465 N Mgmt n/a
10 TRCN0000022365 TCTTACCAGCAATTAGCAGCC pLKO.1 438 CDS 100% 1.200 0.840 N MGMT n/a
11 TRCN0000022366 CTTACCAGCAATTAGCAGCCC pLKO.1 439 CDS 100% 0.540 0.378 N MGMT n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_008598.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.