Transcript: Mouse NM_008605.3

Mus musculus matrix metallopeptidase 12 (Mmp12), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-16
Taxon:
Mus musculus (mouse)
Gene:
Mmp12 (17381)
Length:
3607
CDS:
52..1473

Additional Resources:

NCBI RefSeq record:
NM_008605.3
NBCI Gene record:
Mmp12 (17381)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_008605.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000054696 GCAGCATTCCAATAATCCAAA pLKO.1 741 CDS 100% 4.950 6.930 N Mmp12 n/a
2 TRCN0000031255 CCCATGAATGACAGTGAATTT pLKO.1 139 CDS 100% 13.200 9.240 N Mmp12 n/a
3 TRCN0000031256 CCTCACTTACAGGATCTATAA pLKO.1 402 CDS 100% 13.200 9.240 N Mmp12 n/a
4 TRCN0000054697 GAATGGTACTTGTCAAGATTT pLKO.1 163 CDS 100% 13.200 9.240 N Mmp12 n/a
5 TRCN0000031254 GCCACCAACATTACTTCTATT pLKO.1 1006 CDS 100% 13.200 9.240 N Mmp12 n/a
6 TRCN0000054694 CAAGCTGATTTCCACACACTT pLKO.1 1308 CDS 100% 4.950 3.465 N Mmp12 n/a
7 TRCN0000031258 GATAAACACTACTGGAGGTAT pLKO.1 1252 CDS 100% 4.950 3.465 N Mmp12 n/a
8 TRCN0000054693 CTTACGAAATTGAAAGCAGAA pLKO.1 1067 CDS 100% 4.050 2.835 N Mmp12 n/a
9 TRCN0000054695 GCTCACGGAGACTTCAACTAT pLKO.1 562 CDS 100% 5.625 3.375 N Mmp12 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_008605.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.