Transcript: Mouse NM_008615.2

Mus musculus malic enzyme 1, NADP(+)-dependent, cytosolic (Me1), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Me1 (17436)
Length:
3257
CDS:
165..1883

Additional Resources:

NCBI RefSeq record:
NM_008615.2
NBCI Gene record:
Me1 (17436)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_008615.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000114877 CGAAACAAGTATTGCACATTT pLKO.1 942 CDS 100% 13.200 18.480 N Me1 n/a
2 TRCN0000114878 GCAGTAAAGATTGTGCAAGAT pLKO.1 1704 CDS 100% 4.950 3.960 N Me1 n/a
3 TRCN0000114879 CCAGCAGTACAGTTTGGCATT pLKO.1 494 CDS 100% 4.050 3.240 N Me1 n/a
4 TRCN0000348924 TTCACTTACTGTGGATATTTA pLKO_005 2064 3UTR 100% 15.000 10.500 N Me1 n/a
5 TRCN0000375959 ACAGTTCTTTCTTGACTATTT pLKO_005 2236 3UTR 100% 13.200 9.240 N Me1 n/a
6 TRCN0000348925 TATGGCATGAATTGCCTTATT pLKO_005 870 CDS 100% 13.200 9.240 N Me1 n/a
7 TRCN0000375960 CTGATATGTAGGAAGCTAATG pLKO_005 2159 3UTR 100% 10.800 7.560 N Me1 n/a
8 TRCN0000114880 GCAGTTGAACATTCATGGATT pLKO.1 272 CDS 100% 4.950 2.970 N Me1 n/a
9 TRCN0000114876 CCTGACTTTGAAGTTGCTTTA pLKO.1 2972 3UTR 100% 10.800 5.400 Y Me1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_008615.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.