Transcript: Mouse NM_008648.1

Mus musculus major urinary protein 4 (Mup4), mRNA.

Source:
NCBI, updated 2017-05-13
Taxon:
Mus musculus (mouse)
Gene:
Mup4 (17843)
Length:
875
CDS:
67..603

Additional Resources:

NCBI RefSeq record:
NM_008648.1
NBCI Gene record:
Mup4 (17843)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_008648.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000105476 CTTCCAAGGGACAGAACTTAA pLKO.1 125 CDS 100% 13.200 9.240 N Mup4 n/a
2 TRCN0000105475 CGATACAGCATTGGGTGACAA pLKO.1 672 3UTR 100% 4.950 3.465 N Mup4 n/a
3 TRCN0000105477 GTGATGTATGATGGATTCAAT pLKO.1 358 CDS 100% 5.625 3.375 N Mup4 n/a
4 TRCN0000105478 GCACATCCATGTCTTGGAGAA pLKO.1 243 CDS 100% 4.050 2.430 N Mup4 n/a
5 TRCN0000105479 GAGGAGCATGGAATCATTAAA pLKO.1 529 CDS 100% 15.000 7.500 Y Mup4 n/a
6 TRCN0000270940 ACTTAAGACAGACTATGATAA pLKO_005 390 CDS 100% 13.200 6.600 Y Mup6 n/a
7 TRCN0000272237 TGATGGATTCAATACATTTAC pLKO_005 366 CDS 100% 13.200 6.600 Y Mup7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_008648.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.