Transcript: Mouse NM_008713.4

Mus musculus nitric oxide synthase 3, endothelial cell (Nos3), mRNA.

Source:
NCBI, updated 2017-06-14
Taxon:
Mus musculus (mouse)
Gene:
Nos3 (18127)
Length:
4140
CDS:
20..3628

Additional Resources:

NCBI RefSeq record:
NM_008713.4
NBCI Gene record:
Nos3 (18127)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_008713.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000422907 CTGGAGTATCTTACGTTTAAA pLKO_005 3893 3UTR 100% 15.000 21.000 N Nos3 n/a
2 TRCN0000427156 GATACGCTATGCGGGCTATAG pLKO_005 760 CDS 100% 10.800 15.120 N Nos3 n/a
3 TRCN0000437127 TGACCCTCACCGCTACAACAT pLKO_005 1120 CDS 100% 4.950 6.930 N NOS3 n/a
4 TRCN0000075863 GCCCTCTTCATATGCTTTGAT pLKO.1 3844 3UTR 100% 0.000 0.000 N Nos3 n/a
5 TRCN0000427577 ACTTCATCAATCAGTACTATA pLKO_005 402 CDS 100% 13.200 9.240 N Nos3 n/a
6 TRCN0000428745 ATCAAGAGATGGTCAACTATT pLKO_005 1398 CDS 100% 13.200 9.240 N Nos3 n/a
7 TRCN0000075864 CCACATTAAATACGCAACAAA pLKO.1 655 CDS 100% 5.625 3.938 N Nos3 n/a
8 TRCN0000075866 CCTCACCGCTACAACATACTT pLKO.1 1124 CDS 100% 5.625 3.938 N Nos3 n/a
9 TRCN0000075865 CCTGGTGTTTCCAAGGAAGTT pLKO.1 322 CDS 100% 4.950 3.465 N Nos3 n/a
10 TRCN0000414816 AGATGTTCCAGGCTACAATCC pLKO_005 2286 CDS 100% 4.050 2.835 N NOS3 n/a
11 TRCN0000075867 CTACGAAGAATGGAAGTGGTT pLKO.1 2713 CDS 100% 2.640 1.848 N Nos3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_008713.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.