Transcript: Mouse NM_008719.2

Mus musculus neuronal PAS domain protein 2 (Npas2), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Npas2 (18143)
Length:
4180
CDS:
497..2947

Additional Resources:

NCBI RefSeq record:
NM_008719.2
NBCI Gene record:
Npas2 (18143)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_008719.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000096483 CTCCGAGAATCGAATGTGATA pLKO.1 2306 CDS 100% 4.950 6.930 N Npas2 n/a
2 TRCN0000096481 GCTCCGAGAATCGAATGTGAT pLKO.1 2305 CDS 100% 4.950 6.930 N Npas2 n/a
3 TRCN0000096482 GCAAGAACATTCCGAAGTTTA pLKO.1 901 CDS 100% 13.200 10.560 N Npas2 n/a
4 TRCN0000096479 CCAGCAGCCATCAGGGTAATA pLKO.1 2953 3UTR 100% 13.200 9.240 N Npas2 n/a
5 TRCN0000096480 CCCGCAGTTCTTAAAGGAAAT pLKO.1 1198 CDS 100% 10.800 7.560 N Npas2 n/a
6 TRCN0000022122 CCCAAAGGAATTTCCAACTTA pLKO.1 1030 CDS 100% 5.625 3.375 N NPAS2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_008719.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06653 pDONR223 100% 85.1% 86.9% None (many diffs) n/a
2 ccsbBroad304_06653 pLX_304 0% 85.1% 86.9% V5 (many diffs) n/a
Download CSV