Transcript: Mouse NM_008736.3

Mus musculus neural retina leucine zipper gene (Nrl), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-14
Taxon:
Mus musculus (mouse)
Gene:
Nrl (18185)
Length:
2483
CDS:
193..906

Additional Resources:

NCBI RefSeq record:
NM_008736.3
NBCI Gene record:
Nrl (18185)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_008736.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000085139 TCGAAATAAAGCGGGAGCCTT pLKO.1 254 CDS 100% 2.640 3.696 N Nrl n/a
2 TRCN0000085140 CGACGACCACACACACCTCTT pLKO.1 879 CDS 100% 1.350 1.890 N Nrl n/a
3 TRCN0000424865 TTCAATCTGTAGTGCATTAAT pLKO_005 1322 3UTR 100% 15.000 10.500 N Nrl n/a
4 TRCN0000427810 TCACGACTCTTCATGATTTAG pLKO_005 1107 3UTR 100% 13.200 9.240 N Nrl n/a
5 TRCN0000085138 GCTGTATGTCTGTCACCTTAA pLKO.1 1566 3UTR 100% 10.800 7.560 N Nrl n/a
6 TRCN0000085141 CCTGTCTCTATGGAAGGGCCT pLKO.1 502 CDS 100% 0.180 0.126 N Nrl n/a
7 TRCN0000085142 CGGATGAGGTTCTCGGGCTGA pLKO.1 443 CDS 100% 0.000 0.000 N Nrl n/a
8 TRCN0000432280 GCTTCCCTCCTATCCATATAG pLKO_005 1285 3UTR 100% 13.200 7.920 N Nrl n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_008736.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.