Transcript: Mouse NM_008744.2

Mus musculus netrin 1 (Ntn1), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Ntn1 (18208)
Length:
5757
CDS:
282..2096

Additional Resources:

NCBI RefSeq record:
NM_008744.2
NBCI Gene record:
Ntn1 (18208)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_008744.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000071482 CTATAAGCTATCAGGGCGCAA pLKO.1 1349 CDS 100% 2.160 3.024 N Ntn1 n/a
2 TRCN0000071480 GTGGAAGTTCACCGTGAACAT pLKO.1 1811 CDS 100% 4.950 3.960 N Ntn1 n/a
3 TRCN0000071481 GACCTATGTGAGCCTGCAATT pLKO.1 713 CDS 100% 10.800 7.560 N Ntn1 n/a
4 TRCN0000061945 CATCTACAAGTCCATGGACTA pLKO.1 761 CDS 100% 4.050 2.835 N NTN1 n/a
5 TRCN0000071479 CGACCTCAATAACCCGCACAA pLKO.1 608 CDS 100% 4.050 2.835 N Ntn1 n/a
6 TRCN0000061946 CGCCTTCCTCACCGACCTCAA pLKO.1 596 CDS 100% 0.000 0.000 N NTN1 n/a
7 TRCN0000061943 GTGAACATCATCTCCGTGTAT pLKO.1 1824 CDS 100% 4.950 3.465 N NTN1 n/a
8 TRCN0000431727 GCATCCCGGACTTTGTCAATG pLKO_005 433 CDS 100% 10.800 6.480 N NTN1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_008744.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.