Transcript: Mouse NM_008881.2

Mus musculus plexin A1 (Plxna1), mRNA.

Source:
NCBI, updated 2017-06-11
Taxon:
Mus musculus (mouse)
Gene:
Plxna1 (18844)
Length:
9045
CDS:
281..5965

Additional Resources:

NCBI RefSeq record:
NM_008881.2
NBCI Gene record:
Plxna1 (18844)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_008881.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000340523 TATGCCACAGGAGTGCTAAAG pLKO_005 4481 CDS 100% 10.800 15.120 N Plxna1 n/a
2 TRCN0000079191 GCCGTCTATAGACAACCCAAA pLKO.1 3592 CDS 100% 4.050 5.670 N Plxna1 n/a
3 TRCN0000079188 CCAATTCTTATCGCTGTGGAT pLKO.1 6112 3UTR 100% 2.640 2.112 N Plxna1 n/a
4 TRCN0000306209 TGGTTCTGCCCAGGGATATTT pLKO_005 6204 3UTR 100% 15.000 10.500 N Plxna1 n/a
5 TRCN0000079189 CCGAGGTGAAGTACAACTATA pLKO.1 3387 CDS 100% 13.200 9.240 N Plxna1 n/a
6 TRCN0000325959 CCGAGGTGAAGTACAACTATA pLKO_005 3387 CDS 100% 13.200 9.240 N Plxna1 n/a
7 TRCN0000340522 GGTTCTGCCCAGGGATATTTG pLKO_005 6205 3UTR 100% 13.200 9.240 N Plxna1 n/a
8 TRCN0000306208 GTATGCCACAGGAGTGCTAAA pLKO_005 4480 CDS 100% 10.800 7.560 N Plxna1 n/a
9 TRCN0000079192 CCTGTAGAAGACAATGAGAAA pLKO.1 536 CDS 100% 4.950 3.465 N Plxna1 n/a
10 TRCN0000079190 CCTCTATGCTATGACGGAGAA pLKO.1 1768 CDS 100% 4.050 2.835 N Plxna1 n/a
11 TRCN0000325960 CCTCTATGCTATGACGGAGAA pLKO_005 1768 CDS 100% 4.050 2.835 N Plxna1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_008881.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.