Transcript: Mouse NM_008889.2

Mus musculus protein phosphatase 1, regulatory (inhibitor) subunit 14B (Ppp1r14b), mRNA.

Source:
NCBI, updated 2017-05-14
Taxon:
Mus musculus (mouse)
Gene:
Ppp1r14b (18938)
Length:
919
CDS:
202..645

Additional Resources:

NCBI RefSeq record:
NM_008889.2
NBCI Gene record:
Ppp1r14b (18938)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_008889.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000249719 TCAACCTGGAGGAGTGGATTT pLKO_005 407 CDS 100% 10.800 7.560 N Ppp1r14b n/a
2 TRCN0000249717 AGAACAGCTCACGCGACTCTA pLKO_005 429 CDS 100% 4.950 3.465 N Ppp1r14b n/a
3 TRCN0000249716 AGGGAAGGTCACCGTCAAGTA pLKO_005 360 CDS 100% 4.950 3.465 N Ppp1r14b n/a
4 TRCN0000179928 CGAGATAGATGTGGATGAACT pLKO.1 480 CDS 100% 4.950 3.465 N Ppp1r14b n/a
5 TRCN0000249718 AGACATGGAGAGTGATGATAC pLKO_005 504 CDS 100% 10.800 6.480 N Ppp1r14b n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_008889.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.