Transcript: Mouse NM_008906.4

Mus musculus cathepsin A (Ctsa), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-03
Taxon:
Mus musculus (mouse)
Gene:
Ctsa (19025)
Length:
3301
CDS:
25..1503

Additional Resources:

NCBI RefSeq record:
NM_008906.4
NBCI Gene record:
Ctsa (19025)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_008906.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000032407 CGGACCAGGATGAAATCGATT pLKO.1 152 CDS 100% 4.950 6.930 N Ctsa n/a
2 TRCN0000327414 CGGACCAGGATGAAATCGATT pLKO_005 152 CDS 100% 4.950 6.930 N Ctsa n/a
3 TRCN0000032404 CGCTCAGAACAAGTGTAACTT pLKO.1 786 CDS 100% 5.625 3.938 N Ctsa n/a
4 TRCN0000327339 CGCTCAGAACAAGTGTAACTT pLKO_005 786 CDS 100% 5.625 3.938 N Ctsa n/a
5 TRCN0000032405 CCCTTCCAACTACCTCAACAA pLKO.1 1068 CDS 100% 4.950 3.465 N Ctsa n/a
6 TRCN0000327338 CCCTTCCAACTACCTCAACAA pLKO_005 1068 CDS 100% 4.950 3.465 N Ctsa n/a
7 TRCN0000032406 CCTCAACATCTACAATCTCTA pLKO.1 876 CDS 100% 4.950 3.465 N Ctsa n/a
8 TRCN0000327413 CCTCAACATCTACAATCTCTA pLKO_005 876 CDS 100% 4.950 3.465 N Ctsa n/a
9 TRCN0000032408 CCAAAGCATGAACTCCCAGTA pLKO.1 1182 CDS 100% 4.050 2.835 N Ctsa n/a
10 TRCN0000327337 CCAAAGCATGAACTCCCAGTA pLKO_005 1182 CDS 100% 4.050 2.835 N Ctsa n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_008906.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.