Transcript: Mouse NM_008957.3

Mus musculus patched 1 (Ptch1), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-26
Taxon:
Mus musculus (mouse)
Gene:
Ptch1 (19206)
Length:
7323
CDS:
216..4520

Additional Resources:

NCBI RefSeq record:
NM_008957.3
NBCI Gene record:
Ptch1 (19206)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_008957.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000042542 GCAATGGAAGTTGGAACATTT pLKO.1 758 CDS 100% 13.200 10.560 N Ptch1 n/a
2 TRCN0000326122 GCAATGGAAGTTGGAACATTT pLKO_005 758 CDS 100% 13.200 10.560 N Ptch1 n/a
3 TRCN0000040052 GCGAAGTTTCAGAGACTCTTA pLKO.1 414 CDS 100% 4.950 3.960 N PTCH1 n/a
4 TRCN0000042539 CCTGTCCTCTTATCCTTCTTT pLKO.1 3687 CDS 100% 5.625 3.938 N Ptch1 n/a
5 TRCN0000326121 CCTGTCCTCTTATCCTTCTTT pLKO_005 3687 CDS 100% 5.625 3.938 N Ptch1 n/a
6 TRCN0000042538 GCTCCTTGATTGGCATTTCTT pLKO.1 1636 CDS 100% 5.625 3.938 N Ptch1 n/a
7 TRCN0000042541 CCGAATATCCAGCACCTACTT pLKO.1 2610 CDS 100% 4.950 3.465 N Ptch1 n/a
8 TRCN0000326120 CCGAATATCCAGCACCTACTT pLKO_005 2610 CDS 100% 4.950 3.465 N Ptch1 n/a
9 TRCN0000010497 TAATCCTCAACTCATGATACA pLKO.1 632 CDS 100% 4.950 3.465 N PTCH1 n/a
10 TRCN0000042540 CCTGCAATTCTCAGCATGGAT pLKO.1 1950 CDS 100% 3.000 1.800 N Ptch1 n/a
11 TRCN0000326195 CCTGCAATTCTCAGCATGGAT pLKO_005 1950 CDS 100% 3.000 1.800 N Ptch1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_008957.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11068 pDONR223 100% 11.7% 12.6% None (many diffs) n/a
2 ccsbBroad304_11068 pLX_304 0% 11.7% 12.6% V5 (many diffs) n/a
3 TRCN0000473481 CACGTATCTTCGTGGCCCGCGTTC pLX_317 74.6% 11.7% 12.6% V5 (many diffs) n/a
Download CSV