Transcript: Mouse NM_008973.2

Mus musculus pleiotrophin (Ptn), mRNA.

Source:
NCBI, updated 2017-06-10
Taxon:
Mus musculus (mouse)
Gene:
Ptn (19242)
Length:
2021
CDS:
1471..1977

Additional Resources:

NCBI RefSeq record:
NM_008973.2
NBCI Gene record:
Ptn (19242)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_008973.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000071675 TGACCTCAATACCGCCTTGAA pLKO.1 1797 CDS 100% 4.950 6.930 N Ptn n/a
2 TRCN0000071674 GCTGCCTTCCTGGCATTGATT pLKO.1 1513 CDS 100% 5.625 4.500 N Ptn n/a
3 TRCN0000317996 GCTGCCTTCCTGGCATTGATT pLKO_005 1513 CDS 100% 5.625 4.500 N Ptn n/a
4 TRCN0000071673 CCATGAAGACTCAGAGATGTA pLKO.1 1706 CDS 100% 4.950 3.465 N Ptn n/a
5 TRCN0000317997 CCATGAAGACTCAGAGATGTA pLKO_005 1706 CDS 100% 4.950 3.465 N Ptn n/a
6 TRCN0000071676 GCACAATGCTGACTGTCAGAA pLKO.1 1848 CDS 100% 4.950 3.465 N Ptn n/a
7 TRCN0000317926 GCACAATGCTGACTGTCAGAA pLKO_005 1848 CDS 100% 4.950 3.465 N Ptn n/a
8 TRCN0000071677 CGCCGAGTGCAAACAGACCAT pLKO.1 1689 CDS 100% 0.880 0.616 N Ptn n/a
9 TRCN0000349473 CGCCGAGTGCAAACAGACCAT pLKO_005 1689 CDS 100% 0.880 0.616 N Ptn n/a
10 TRCN0000002774 AGGCAAGAAACAGGAGAAGAT pLKO.1 1947 CDS 100% 4.950 2.970 N PTN n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_008973.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.