Transcript: Mouse NM_008997.3

Mus musculus RAB11B, member RAS oncogene family (Rab11b), mRNA.

Source:
NCBI, updated 2017-05-14
Taxon:
Mus musculus (mouse)
Gene:
Rab11b (19326)
Length:
6065
CDS:
225..881

Additional Resources:

NCBI RefSeq record:
NM_008997.3
NBCI Gene record:
Rab11b (19326)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_008997.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000100257 CCTATTCAAAGTGGTGCTTAT pLKO.1 254 CDS 100% 10.800 15.120 N Rab11b n/a
2 TRCN0000325086 CCTATTCAAAGTGGTGCTTAT pLKO_005 254 CDS 100% 10.800 15.120 N Rab11b n/a
3 TRCN0000100258 CAAGACCATCAAGGCTCAGAT pLKO.1 395 CDS 100% 4.950 3.465 N Rab11b n/a
4 TRCN0000325158 CAAGACCATCAAGGCTCAGAT pLKO_005 395 CDS 100% 4.950 3.465 N Rab11b n/a
5 TRCN0000380618 CATTCAAGAACATCCTCACAG pLKO_005 715 CDS 100% 4.050 2.835 N RAB11B n/a
6 TRCN0000100256 CCTCACAGAAATCTACCGTAT pLKO.1 728 CDS 100% 4.050 2.835 N Rab11b n/a
7 TRCN0000325157 CCTCACAGAAATCTACCGTAT pLKO_005 728 CDS 100% 4.050 2.835 N Rab11b n/a
8 TRCN0000100259 CCTAGAGAGCAAGAGTACCAT pLKO.1 335 CDS 100% 3.000 2.100 N Rab11b n/a
9 TRCN0000325159 CCTAGAGAGCAAGAGTACCAT pLKO_005 335 CDS 100% 3.000 2.100 N Rab11b n/a
10 TRCN0000100255 CCTGTCTGCAAGTGAAGCAAT pLKO.1 1747 3UTR 100% 4.950 2.970 N Rab11b n/a
11 TRCN0000325160 CCTGTCTGCAAGTGAAGCAAT pLKO_005 1747 3UTR 100% 4.950 2.970 N Rab11b n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_008997.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07378 pDONR223 100% 91.5% 99% None (many diffs) n/a
2 ccsbBroad304_07378 pLX_304 0% 91.5% 99% V5 (many diffs) n/a
Download CSV