Transcript: Mouse NM_009076.3

Mus musculus ribosomal protein L12 (Rpl12), mRNA.

Source:
NCBI, updated 2019-09-22
Taxon:
Mus musculus (mouse)
Gene:
Rpl12 (269261)
Length:
643
CDS:
92..589

Additional Resources:

NCBI RefSeq record:
NM_009076.3
NBCI Gene record:
Rpl12 (269261)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_009076.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000421705 TTGATGAGATTGTCAACATTG pLKO_005 408 CDS 100% 10.800 5.400 Y RPL12 n/a
2 TRCN0000104323 CAGGAAGAAGCAGAAGAACAT pLKO.1 364 CDS 100% 4.950 2.475 Y Rpl12 n/a
3 TRCN0000104324 CATTAAACACAGTGGGAACAT pLKO.1 382 CDS 100% 4.950 2.475 Y Rpl12 n/a
4 TRCN0000104321 CTAGAGAACTTTCTGGAACTA pLKO.1 456 CDS 100% 4.950 2.475 Y Rpl12 n/a
5 TRCN0000104320 CCTGATCATCAAAGCCCTCAA pLKO.1 328 CDS 100% 4.050 2.025 Y Rpl12 n/a
6 TRCN0000104322 GCGATGACATTGCCAAGGCTA pLKO.1 219 CDS 100% 2.640 1.320 Y Rpl12 n/a
7 TRCN0000430045 AGAACAGACAGGCCCAGATTG pLKO_005 285 CDS 100% 10.800 5.400 Y RPL12 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_009076.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11105 pDONR223 100% 71.3% 79.3% None (many diffs) n/a
2 ccsbBroad304_11105 pLX_304 0% 71.3% 79.3% V5 (many diffs) n/a
Download CSV