Transcript: Mouse NM_009137.2

Mus musculus chemokine (C-C motif) ligand 22 (Ccl22), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Ccl22 (20299)
Length:
1815
CDS:
31..309

Additional Resources:

NCBI RefSeq record:
NM_009137.2
NBCI Gene record:
Ccl22 (20299)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_009137.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000067835 GCCATCACGTTTAGTGAAGGA pLKO.1 165 CDS 100% 2.640 2.112 N Ccl22 n/a
2 TRCN0000067833 GCTCAGAATCAGATTTCTTAA pLKO.1 947 3UTR 100% 13.200 9.240 N Ccl22 n/a
3 TRCN0000067837 GTGCCAATGTGGAAGACAGTA pLKO.1 113 CDS 100% 4.950 3.465 N Ccl22 n/a
4 TRCN0000067834 GCTACTCCATAAACTGTCCTA pLKO.1 288 CDS 100% 2.640 1.848 N Ccl22 n/a
5 TRCN0000067836 TGGGTGAAGAAGCTACTCCAT pLKO.1 277 CDS 100% 2.640 1.848 N Ccl22 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_009137.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.