Transcript: Mouse NM_009154.2

Mus musculus sema domain, seven thrombospondin repeats (type 1 and type 1-like), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 5A (Sema5a), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Sema5a (20356)
Length:
10809
CDS:
659..3883

Additional Resources:

NCBI RefSeq record:
NM_009154.2
NBCI Gene record:
Sema5a (20356)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_009154.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000094791 CGAGAAACTATCTCTTCAGAT pLKO.1 879 CDS 100% 4.950 3.960 N Sema5a n/a
2 TRCN0000094790 GCAGCCAATGTTCTGGAAATA pLKO.1 3438 CDS 100% 13.200 9.240 N Sema5a n/a
3 TRCN0000094789 GCACACCCTTAAATGCCTAAA pLKO.1 4033 3UTR 100% 10.800 7.560 N Sema5a n/a
4 TRCN0000094793 CCTGGTCTAAATGTTCAGCAA pLKO.1 3204 CDS 100% 2.640 1.848 N Sema5a n/a
5 TRCN0000166364 CACACACACACACACACACAA pLKO.1 6343 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_009154.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.