Transcript: Mouse NM_009167.3

Mus musculus src homology 2 domain-containing transforming protein C3 (Shc3), mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Shc3 (20418)
Length:
1540
CDS:
4..1428

Additional Resources:

NCBI RefSeq record:
NM_009167.3
NBCI Gene record:
Shc3 (20418)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_009167.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000114699 CTGCGCTCAATGAGGTCTCTT pLKO.1 139 CDS 100% 4.950 6.930 N Shc3 n/a
2 TRCN0000114696 CCTGACTCCAAACAGATCATA pLKO.1 358 CDS 100% 5.625 3.938 N Shc3 n/a
3 TRCN0000114698 GAAGACACTTAGGAGATACAT pLKO.1 788 CDS 100% 5.625 3.938 N Shc3 n/a
4 TRCN0000114700 GCATCGAAGTTCTGCGCTCAA pLKO.1 128 CDS 100% 4.050 2.835 N Shc3 n/a
5 TRCN0000114697 GCCTTTGAACTCCGGTTCAAA pLKO.1 541 CDS 100% 0.563 0.281 Y Shc3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_009167.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.