Transcript: Mouse NM_009186.5

Mus musculus transformer 2 beta homolog (Drosophila) (Tra2b), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-04-24
Taxon:
Mus musculus (mouse)
Gene:
Tra2b (20462)
Length:
3416
CDS:
230..1096

Additional Resources:

NCBI RefSeq record:
NM_009186.5
NBCI Gene record:
Tra2b (20462)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_009186.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000109282 GTTATGATGACCGGGACTATT pLKO.1 915 CDS 100% 13.200 18.480 N Tra2b n/a
2 TRCN0000309919 GTTATGATGACCGGGACTATT pLKO_005 915 CDS 100% 13.200 18.480 N Tra2b n/a
3 TRCN0000109281 GCGTCGAATTAGAGTCGATTT pLKO.1 787 CDS 100% 10.800 15.120 N Tra2b n/a
4 TRCN0000305430 ATCACGATCTCGCTCGCATAG pLKO_005 445 CDS 100% 6.000 8.400 N Tra2b n/a
5 TRCN0000305485 AGACCCACTTATGGCAGTTCT pLKO_005 857 CDS 100% 4.950 6.930 N Tra2b n/a
6 TRCN0000109283 CCAGGTCTGAATCTAGGTCTA pLKO.1 384 CDS 100% 4.050 5.670 N Tra2b n/a
7 TRCN0000109280 CGGTGCTTTGTTCAAAGTTAA pLKO.1 1283 3UTR 100% 13.200 9.240 N Tra2b n/a
8 TRCN0000309855 CGGTGCTTTGTTCAAAGTTAA pLKO_005 1283 3UTR 100% 13.200 9.240 N Tra2b n/a
9 TRCN0000305484 TGCTGATGTGTCTATTGTATA pLKO_005 661 CDS 100% 13.200 9.240 N Tra2b n/a
10 TRCN0000000116 GAAGCTAAAGAACGTGCCAAT pLKO.1 749 CDS 100% 4.050 2.835 N TRA2B n/a
11 TRCN0000109284 CTAAGAGAAGTGTTCTCTAAA pLKO.1 629 CDS 100% 1.320 0.792 N Tra2b n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_009186.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.