Transcript: Mouse NM_009197.2

Mus musculus solute carrier family 16 (monocarboxylic acid transporters), member 2 (Slc16a2), mRNA.

Source:
NCBI, updated 2017-06-04
Taxon:
Mus musculus (mouse)
Gene:
Slc16a2 (20502)
Length:
4180
CDS:
187..1824

Additional Resources:

NCBI RefSeq record:
NM_009197.2
NBCI Gene record:
Slc16a2 (20502)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_009197.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000413523 GTACTTCAACATGCGTGTATT pLKO_005 1131 CDS 100% 13.200 18.480 N Slc16a2 n/a
2 TRCN0000079560 CGCTACTTCACCTATGGGATT pLKO.1 793 CDS 100% 4.050 5.670 N Slc16a2 n/a
3 TRCN0000038373 GAGTATATTCACTGACCGTTT pLKO.1 687 CDS 100% 4.050 5.670 N SLC16A2 n/a
4 TRCN0000079559 CCCTGGACTTAAGAAGATATA pLKO.1 1347 CDS 100% 13.200 9.240 N Slc16a2 n/a
5 TRCN0000447159 CCTACGTGCACCTGATGAAAT pLKO_005 1217 CDS 100% 13.200 9.240 N Slc16a2 n/a
6 TRCN0000412544 TCGAAACTGCTTTGGTGATTA pLKO_005 1611 CDS 100% 13.200 9.240 N Slc16a2 n/a
7 TRCN0000079558 GCCAAGAAATGAACTGCTTTA pLKO.1 2882 3UTR 100% 10.800 7.560 N Slc16a2 n/a
8 TRCN0000079562 GCATCAAAGGATGTTTAAGAA pLKO.1 1704 CDS 100% 5.625 3.938 N Slc16a2 n/a
9 TRCN0000079561 CCATGCTACTAGAGGAGGAAA pLKO.1 581 CDS 100% 4.950 3.465 N Slc16a2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_009197.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.