Transcript: Mouse NM_009220.2

Mus musculus spermiogenesis specific transcript on the Y 1 (Ssty1), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Ssty1 (20611)
Length:
1285
CDS:
468..1166

Additional Resources:

NCBI RefSeq record:
NM_009220.2
NBCI Gene record:
Ssty1 (20611)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_009220.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000246753 AGAGCGGTACAACACAAATTT pLKO_005 771 CDS 100% 15.000 7.500 Y Ssty1 n/a
2 TRCN0000246754 CCAACACCCTGAGGAATATTG pLKO_005 508 CDS 100% 13.200 6.600 Y Ssty1 n/a
3 TRCN0000263182 CCAATCCTTCCGTGTACTTTA pLKO_005 1072 CDS 100% 13.200 6.600 Y Gm20831 n/a
4 TRCN0000282512 GAGCGGTACAACACAAATTTG pLKO_005 772 CDS 100% 13.200 6.600 Y Gm20831 n/a
5 TRCN0000179795 GCCAACAAACCCTTCTCTTTA pLKO.1 608 CDS 100% 13.200 6.600 Y Gm20738 n/a
6 TRCN0000282514 TTGCCTCCCATAGTAGTATTT pLKO_005 708 CDS 100% 13.200 6.600 Y Gm20831 n/a
7 TRCN0000246752 TTTGCCTCCCATAGTAGTATT pLKO_005 707 CDS 100% 13.200 6.600 Y Ssty1 n/a
8 TRCN0000263183 ATGGTGACATCCATATCTATG pLKO_005 1102 CDS 100% 10.800 5.400 Y Gm20831 n/a
9 TRCN0000246755 CATATCTATGTCTATACTATG pLKO_005 1113 CDS 100% 10.800 5.400 Y Ssty1 n/a
10 TRCN0000215771 CCGTGTACTTTATCAAGTTTC pLKO.1 1081 CDS 100% 10.800 5.400 Y Ssty1 n/a
11 TRCN0000246756 CCGTGTACTTTATCAAGTTTC pLKO_005 1081 CDS 100% 10.800 5.400 Y Ssty1 n/a
12 TRCN0000263181 CTAGATCAACTGCCAACAAAC pLKO_005 597 CDS 100% 10.800 5.400 Y Gm20831 n/a
13 TRCN0000200581 CCAATCATGAAGGATTTGTTT pLKO.1 846 CDS 100% 5.625 2.813 Y Ssty1 n/a
14 TRCN0000347929 CAGCTCCTGGATGACTACAAG pLKO_005 906 CDS 100% 4.950 2.475 Y Gm20865 n/a
15 TRCN0000191781 GTGCCAAAGATTCTTGAAGTT pLKO.1 1134 CDS 100% 4.950 2.475 Y Ssty1 n/a
16 TRCN0000202239 GAAGGAAGGTAATGAGCCTGT pLKO.1 554 CDS 100% 2.160 1.080 Y Gm20747 n/a
17 TRCN0000191653 GACATCCATATCTATGTCTAT pLKO.1 1107 CDS 100% 0.495 0.248 Y Ssty1 n/a
18 TRCN0000347896 CAACAAACCCTTCTCTTTATT pLKO_005 610 CDS 100% 15.000 7.500 Y Gm21394 n/a
19 TRCN0000347820 CCAACAAACCCTTCTCTTTAT pLKO_005 609 CDS 100% 13.200 6.600 Y Gm20823 n/a
20 TRCN0000179232 GTTCGGAAAGGTTGTTTACAA pLKO.1 1043 CDS 100% 5.625 2.813 Y Ssty2 n/a
21 TRCN0000202389 GTAATGAGCCTGTCACCCATT pLKO.1 562 CDS 100% 4.050 2.025 Y Gm20747 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_009220.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.