Transcript: Mouse NM_009229.4

Mus musculus syntrophin, basic 2 (Sntb2), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Sntb2 (20650)
Length:
4423
CDS:
53..1615

Additional Resources:

NCBI RefSeq record:
NM_009229.4
NBCI Gene record:
Sntb2 (20650)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_009229.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000112918 CAAAGCCGATTGTATTTGTAT pLKO.1 1545 CDS 100% 5.625 7.875 N Sntb2 n/a
2 TRCN0000303926 TAGCTATCCACACCAACATAA pLKO_005 870 CDS 100% 13.200 10.560 N SNTB2 n/a
3 TRCN0000053524 CCGAGAAGTAACACCATATAT pLKO.1 583 CDS 100% 15.000 10.500 N SNTB2 n/a
4 TRCN0000300037 CCGAGAAGTAACACCATATAT pLKO_005 583 CDS 100% 15.000 10.500 N SNTB2 n/a
5 TRCN0000112919 GAGAAGGACTTGCTACTTTAT pLKO.1 1052 CDS 100% 13.200 9.240 N Sntb2 n/a
6 TRCN0000112915 GCCTAGAAATTGGTATCAAAT pLKO.1 3936 3UTR 100% 13.200 9.240 N Sntb2 n/a
7 TRCN0000112917 CCAAAGCCGATTGTATTTGTA pLKO.1 1544 CDS 100% 5.625 3.938 N Sntb2 n/a
8 TRCN0000112916 GTCAAATTCATCCGAGAAGTA pLKO.1 572 CDS 100% 4.950 3.465 N Sntb2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_009229.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.