Transcript: Mouse NM_009231.2

Mus musculus son of sevenless homolog 1 (Drosophila) (Sos1), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Sos1 (20662)
Length:
8919
CDS:
531..4490

Additional Resources:

NCBI RefSeq record:
NM_009231.2
NBCI Gene record:
Sos1 (20662)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_009231.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000348731 GCTGTAGTAAGTCGGATAATT pLKO_005 3078 CDS 100% 15.000 21.000 N Sos1 n/a
2 TRCN0000348729 TTTGACCCGTATGAGTCATAT pLKO_005 1404 CDS 100% 13.200 18.480 N Sos1 n/a
3 TRCN0000065423 CGGATAATTGAGATTCTACAA pLKO.1 3090 CDS 100% 4.950 6.930 N Sos1 n/a
4 TRCN0000348732 GACACGGGAAAGAGCTTATTA pLKO_005 3379 CDS 100% 15.000 12.000 N Sos1 n/a
5 TRCN0000348730 TCTACTTCACGATGTAGTATA pLKO_005 4601 3UTR 100% 13.200 10.560 N Sos1 n/a
6 TRCN0000065425 CCAGGTCATAACATTACATTT pLKO.1 2772 CDS 100% 13.200 9.240 N Sos1 n/a
7 TRCN0000065427 CCACCAGGTTTCTGTTTACAT pLKO.1 899 CDS 100% 5.625 3.938 N Sos1 n/a
8 TRCN0000351968 CCACCAGGTTTCTGTTTACAT pLKO_005 899 CDS 100% 5.625 3.938 N Sos1 n/a
9 TRCN0000065424 CCCATCCAAGATTATGTCTAA pLKO.1 3989 CDS 100% 4.950 3.465 N Sos1 n/a
10 TRCN0000065426 GCACTTTATTTGCAGTCCATA pLKO.1 1491 CDS 100% 4.950 3.465 N Sos1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_009231.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.