Transcript: Mouse NM_009289.3

Mus musculus STE20-like kinase (Slk), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Slk (20874)
Length:
7047
CDS:
176..3877

Additional Resources:

NCBI RefSeq record:
NM_009289.3
NBCI Gene record:
Slk (20874)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_009289.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000361479 TGCTATAGAATTGGGATAATT pLKO_005 4275 3UTR 100% 15.000 21.000 N Slk n/a
2 TRCN0000025271 CGCTACAATCAACGACTTATT pLKO.1 3320 CDS 100% 13.200 18.480 N Slk n/a
3 TRCN0000025272 GCACAGAAAGTGCCCGTTAAA pLKO.1 2222 CDS 100% 13.200 18.480 N Slk n/a
4 TRCN0000025270 CCTGTCTTAATACCCAGTATT pLKO.1 2288 CDS 100% 13.200 10.560 N Slk n/a
5 TRCN0000361548 TATGGTTGAGATTGACATATT pLKO_005 403 CDS 100% 13.200 10.560 N Slk n/a
6 TRCN0000025273 GCAGACATTAGAGGCATTGAA pLKO.1 586 CDS 100% 5.625 3.938 N Slk n/a
7 TRCN0000025269 GCCCAGAATAAAGAGACCAAT pLKO.1 326 CDS 100% 4.950 3.465 N Slk n/a
8 TRCN0000361480 ACGAAGCCAAGCGCATCAAAG pLKO_005 2874 CDS 100% 10.800 6.480 N Slk n/a
9 TRCN0000092942 GAAGATGAGGAGGAGGAAGAA pLKO.1 1136 CDS 100% 4.950 2.475 Y Gm13232 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_009289.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.