Transcript: Mouse NM_009320.4

Mus musculus solute carrier family 6 (neurotransmitter transporter, taurine), member 6 (Slc6a6), mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Slc6a6 (21366)
Length:
6169
CDS:
298..2163

Additional Resources:

NCBI RefSeq record:
NM_009320.4
NBCI Gene record:
Slc6a6 (21366)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_009320.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000271666 TGCGTTCCTCATACCGTATTT pLKO_005 528 CDS 100% 13.200 18.480 N Slc6a6 n/a
2 TRCN0000271729 TTCGTTCAACGGAACCTTAAA pLKO_005 3874 3UTR 100% 13.200 18.480 N Slc6a6 n/a
3 TRCN0000079841 CCTGGATATATGGCGGTGATA pLKO.1 1736 CDS 100% 4.950 6.930 N Slc6a6 n/a
4 TRCN0000079839 CGTGAGAATCAAATACCTGAT pLKO.1 2016 CDS 100% 4.050 5.670 N Slc6a6 n/a
5 TRCN0000079840 CGACGCTGGAACTCAGATATT pLKO.1 1173 CDS 100% 13.200 9.240 N Slc6a6 n/a
6 TRCN0000271727 GCTATAACAAGTACAAGTATA pLKO_005 1238 CDS 100% 13.200 9.240 N Slc6a6 n/a
7 TRCN0000271667 GGTCCAGCAAGATCGACTTTG pLKO_005 428 CDS 100% 10.800 7.560 N Slc6a6 n/a
8 TRCN0000079842 CCTGACCTACAACAAAGTGTA pLKO.1 1884 CDS 100% 4.950 3.465 N Slc6a6 n/a
9 TRCN0000079838 GCCAACAAGAAAGATGCCAAA pLKO.1 2800 3UTR 100% 4.050 2.835 N Slc6a6 n/a
10 TRCN0000271728 GCTACGCATCCATCGTCATTG pLKO_005 668 CDS 100% 10.800 6.480 N Slc6a6 n/a
11 TRCN0000166364 CACACACACACACACACACAA pLKO.1 5869 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_009320.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13956 pDONR223 100% 28.8% .4% None (many diffs) n/a
2 ccsbBroad304_13956 pLX_304 0% 28.8% .4% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV