Transcript: Mouse NM_009325.4

Mus musculus thromboxane A2 receptor (Tbxa2r), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-03
Taxon:
Mus musculus (mouse)
Gene:
Tbxa2r (21390)
Length:
1963
CDS:
457..1482

Additional Resources:

NCBI RefSeq record:
NM_009325.4
NBCI Gene record:
Tbxa2r (21390)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_009325.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000453158 CTAAGGACGGAGCTACGACAT pLKO_005 1565 3UTR 100% 4.050 5.670 N Tbxa2r n/a
2 TRCN0000027776 CGGCCTTGTTCTCACCGACTT pLKO.1 657 CDS 100% 1.350 1.890 N Tbxa2r n/a
3 TRCN0000027825 CCCGGTGAACATCACGCTGCA pLKO.1 495 CDS 100% 0.000 0.000 N Tbxa2r n/a
4 TRCN0000027803 CGTGGTCTTCGGGCTCATATT pLKO.1 1029 CDS 100% 13.200 10.560 N Tbxa2r n/a
5 TRCN0000027833 CTTCATCATGCAGACTTTGTT pLKO.1 1236 CDS 100% 5.625 4.500 N Tbxa2r n/a
6 TRCN0000027771 CCCTGGGTCTATATCCTCTTT pLKO.1 1360 CDS 100% 4.950 3.465 N Tbxa2r n/a
7 TRCN0000454141 GGGTAGCTATGGTGTTCTTCG pLKO_005 779 CDS 100% 4.050 2.835 N Tbxa2r n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_009325.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.