Transcript: Mouse NM_009373.3

Mus musculus transglutaminase 2, C polypeptide (Tgm2), mRNA.

Source:
NCBI, updated 2017-06-04
Taxon:
Mus musculus (mouse)
Gene:
Tgm2 (21817)
Length:
3549
CDS:
93..2153

Additional Resources:

NCBI RefSeq record:
NM_009373.3
NBCI Gene record:
Tgm2 (21817)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_009373.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000009530 CGGGAATATGTCCTTACGCAA pLKO.1 561 CDS 100% 2.640 3.696 N Tgm2 n/a
2 TRCN0000278096 CGGGAATATGTCCTTACGCAA pLKO_005 561 CDS 100% 2.640 3.696 N Tgm2 n/a
3 TRCN0000009533 CCTGGAGAATCCCGAAATCAA pLKO.1 1838 CDS 100% 5.625 3.938 N Tgm2 n/a
4 TRCN0000297389 CCTGGAGAATCCCGAAATCAA pLKO_005 1838 CDS 100% 5.625 3.938 N Tgm2 n/a
5 TRCN0000009529 CCTGGTCTTTATCCTAAGATA pLKO.1 2202 3UTR 100% 5.625 3.938 N Tgm2 n/a
6 TRCN0000278097 CCTGGTCTTTATCCTAAGATA pLKO_005 2202 3UTR 100% 5.625 3.938 N Tgm2 n/a
7 TRCN0000009531 CGCTTCTCACTGTCTGACAAT pLKO.1 318 CDS 100% 4.950 3.465 N Tgm2 n/a
8 TRCN0000278095 CGCTTCTCACTGTCTGACAAT pLKO_005 318 CDS 100% 4.950 3.465 N Tgm2 n/a
9 TRCN0000009532 CCTGACAGAGTCAAACCTCAT pLKO.1 1751 CDS 100% 4.050 2.430 N Tgm2 n/a
10 TRCN0000278098 CCTGACAGAGTCAAACCTCAT pLKO_005 1751 CDS 100% 4.050 2.430 N Tgm2 n/a
11 TRCN0000284851 TTGTGCTGGGCCACTTCATTT pLKO_005 481 CDS 100% 13.200 9.240 N TGM2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_009373.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.