Transcript: Mouse NM_009433.3

Mus musculus testis-specific protein, Y-encoded-like 1 (Tspyl1), mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Tspyl1 (22110)
Length:
2696
CDS:
92..1231

Additional Resources:

NCBI RefSeq record:
NM_009433.3
NBCI Gene record:
Tspyl1 (22110)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_009433.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000305144 CTCAGTTGTCCGCCATGATTA pLKO_005 777 CDS 100% 13.200 18.480 N Tspyl1 n/a
2 TRCN0000305081 GCACCACTTTCTAGGTTATAT pLKO_005 1687 3UTR 100% 15.000 12.000 N Tspyl1 n/a
3 TRCN0000106390 CCTGGCTTATACCCTTTCTAA pLKO.1 1440 3UTR 100% 5.625 4.500 N Tspyl1 n/a
4 TRCN0000106393 CAAGCTGATTGTCAAGGAATA pLKO.1 916 CDS 100% 10.800 7.560 N Tspyl1 n/a
5 TRCN0000308634 CAAGCTGATTGTCAAGGAATA pLKO_005 916 CDS 100% 10.800 7.560 N Tspyl1 n/a
6 TRCN0000106391 CCAGTCCTTCATTCGCAGAAA pLKO.1 1006 CDS 100% 4.950 3.465 N Tspyl1 n/a
7 TRCN0000140845 CCAGTCCTTCATTCGCAGAAA pLKO.1 1006 CDS 100% 4.950 3.465 N TSPYL1 n/a
8 TRCN0000308691 CCAGTCCTTCATTCGCAGAAA pLKO_005 1006 CDS 100% 4.950 3.465 N Tspyl1 n/a
9 TRCN0000106394 GACACCGAAATATGTGGAGAA pLKO.1 352 CDS 100% 4.050 2.835 N Tspyl1 n/a
10 TRCN0000106392 GCAGAGATGTTAAGGTACGTA pLKO.1 809 CDS 100% 3.000 2.100 N Tspyl1 n/a
11 TRCN0000308692 GCAGAGATGTTAAGGTACGTA pLKO_005 809 CDS 100% 3.000 2.100 N Tspyl1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_009433.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.