Transcript: Mouse NM_009455.3

Mus musculus ubiquitin-conjugating enzyme E2E 1 (Ube2e1), mRNA.

Source:
NCBI, updated 2017-05-13
Taxon:
Mus musculus (mouse)
Gene:
Ube2e1 (22194)
Length:
1386
CDS:
192..773

Additional Resources:

NCBI RefSeq record:
NM_009455.3
NBCI Gene record:
Ube2e1 (22194)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_009455.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000377033 GAGTTTGTTACCTCGTATATG pLKO_005 1161 3UTR 100% 13.200 18.480 N Ube2e1 n/a
2 TRCN0000040809 CCCAGCCCTAACCATCTCGAA pLKO.1 611 CDS 100% 0.880 1.232 N Ube2e1 n/a
3 TRCN0000316544 CCCAGCCCTAACCATCTCGAA pLKO_005 611 CDS 100% 0.880 1.232 N Ube2e1 n/a
4 TRCN0000304885 TTCTCTCCACCAGCGCTAAGA pLKO_005 322 CDS 100% 4.950 3.960 N Ube2e1 n/a
5 TRCN0000040812 CTATGAGTGGAGATCAACCAT pLKO.1 419 CDS 100% 3.000 2.400 N Ube2e1 n/a
6 TRCN0000316543 CTATGAGTGGAGATCAACCAT pLKO_005 419 CDS 100% 3.000 2.400 N Ube2e1 n/a
7 TRCN0000040810 CCCAAGAAGAAGGAGAGTAAA pLKO.1 276 CDS 100% 13.200 9.240 N Ube2e1 n/a
8 TRCN0000348958 GAGCTGGCAGACATCACTTTA pLKO_005 354 CDS 100% 13.200 9.240 N Ube2e1 n/a
9 TRCN0000040811 CAAAGGTTACATTTCGTACAA pLKO.1 523 CDS 100% 4.950 3.465 N Ube2e1 n/a
10 TRCN0000040808 TGGAGTATTCTTCCTTGACAT pLKO.1 470 CDS 100% 4.950 3.465 N Ube2e1 n/a
11 TRCN0000004016 CCTCCTTTCTATCTGCTCACT pLKO.1 635 CDS 100% 2.640 1.848 N UBE2E1 n/a
12 TRCN0000279827 CCTCCTTTCTATCTGCTCACT pLKO_005 635 CDS 100% 2.640 1.848 N UBE2E1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_009455.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.