Transcript: Mouse NM_009525.3

Mus musculus wingless-type MMTV integration site family, member 5B (Wnt5b), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-26
Taxon:
Mus musculus (mouse)
Gene:
Wnt5b (22419)
Length:
2384
CDS:
425..1504

Additional Resources:

NCBI RefSeq record:
NM_009525.3
NBCI Gene record:
Wnt5b (22419)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_009525.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000071813 GCCGTGTATAAGATGGCTGAT pLKO.1 1046 CDS 100% 4.050 5.670 N Wnt5b n/a
2 TRCN0000226379 GACCGGAGATGTTCATCATTG pLKO_005 531 CDS 100% 10.800 8.640 N Wnt5b n/a
3 TRCN0000226380 ATCTGTCTTTGGCAGAGTTAT pLKO_005 724 CDS 100% 13.200 9.240 N Wnt5b n/a
4 TRCN0000218151 GATGAAGGAACTGGACTTATT pLKO_005 1808 3UTR 100% 13.200 9.240 N Wnt5b n/a
5 TRCN0000226382 CTGACTACTGCCTGCGTAATG pLKO_005 1278 CDS 100% 10.800 7.560 N Wnt5b n/a
6 TRCN0000071814 CGAGAGCGTGAGAAGAACTTT pLKO.1 959 CDS 100% 5.625 3.938 N Wnt5b n/a
7 TRCN0000071816 GAGACCGGAGATGTTCATCAT pLKO.1 529 CDS 100% 4.950 3.465 N Wnt5b n/a
8 TRCN0000071817 GTGTTGCTTTGTCAGATGCAA pLKO.1 1444 CDS 100% 3.000 2.100 N Wnt5b n/a
9 TRCN0000226381 ACCGCTTTGCCAAGGAGTTTG pLKO_005 930 CDS 100% 10.800 6.480 N Wnt5b n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_009525.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.