Transcript: Mouse NM_009543.3

Mus musculus ring finger protein 103 (Rnf103), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-10
Taxon:
Mus musculus (mouse)
Gene:
Rnf103 (22644)
Length:
3296
CDS:
787..2838

Additional Resources:

NCBI RefSeq record:
NM_009543.3
NBCI Gene record:
Rnf103 (22644)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_009543.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000320472 CTTACCAATGTGGCGATTTAA pLKO_005 2316 CDS 100% 15.000 21.000 N RNF103 n/a
2 TRCN0000447345 GACGAAGACCCTGACTTATTC pLKO_005 2230 CDS 100% 13.200 18.480 N Rnf103 n/a
3 TRCN0000430093 GATGTTGATGACAGAATTTAT pLKO_005 2968 3UTR 100% 15.000 12.000 N Rnf103 n/a
4 TRCN0000320469 CTCTGATACCAACTGATTATA pLKO_005 2288 CDS 100% 15.000 10.500 N RNF103 n/a
5 TRCN0000412652 AGCGATTTGTGGTTCTCATAA pLKO_005 1838 CDS 100% 13.200 9.240 N Rnf103 n/a
6 TRCN0000007492 CCCTCTGATACCAACTGATTA pLKO.1 2286 CDS 100% 13.200 9.240 N RNF103 n/a
7 TRCN0000428813 TGACAGGAAATACACATTATG pLKO_005 2945 3UTR 100% 13.200 9.240 N Rnf103 n/a
8 TRCN0000040940 GCCACAAACAAGTACATCTAA pLKO.1 1317 CDS 100% 5.625 3.938 N Rnf103 n/a
9 TRCN0000040941 GCTCATTACAACCTGAAGTAA pLKO.1 1736 CDS 100% 5.625 3.938 N Rnf103 n/a
10 TRCN0000040939 GCCAGCTTTCTTCTCTGCATT pLKO.1 1524 CDS 100% 4.950 3.465 N Rnf103 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_009543.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.