Transcript: Mouse NM_009560.2

Mus musculus zinc finger protein 60 (Zfp60), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-14
Taxon:
Mus musculus (mouse)
Gene:
Zfp60 (22718)
Length:
4057
CDS:
277..2391

Additional Resources:

NCBI RefSeq record:
NM_009560.2
NBCI Gene record:
Zfp60 (22718)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_009560.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000348997 GCTGGTATGAAACCGTATAAA pLKO_005 1114 CDS 100% 15.000 21.000 N Zfp60 n/a
2 TRCN0000075535 CCCTGGCTATAGTGTAATCAA pLKO.1 666 CDS 100% 5.625 4.500 N Zfp60 n/a
3 TRCN0000301413 CCCTGGCTATAGTGTAATCAA pLKO_005 666 CDS 100% 5.625 4.500 N Zfp60 n/a
4 TRCN0000075534 GCCTTGTGGAACATAGGATTA pLKO.1 1844 CDS 100% 10.800 7.560 N Zfp60 n/a
5 TRCN0000301412 GCCTTGTGGAACATAGGATTA pLKO_005 1844 CDS 100% 10.800 7.560 N Zfp60 n/a
6 TRCN0000075537 CCAGACGATTCATAATGGAAA pLKO.1 2025 CDS 100% 4.950 3.465 N Zfp60 n/a
7 TRCN0000301411 CCAGACGATTCATAATGGAAA pLKO_005 2025 CDS 100% 4.950 3.465 N Zfp60 n/a
8 TRCN0000349019 GTATCCATGCTGTCGTGAAAC pLKO_005 2690 3UTR 100% 10.800 6.480 N Zfp60 n/a
9 TRCN0000234273 ATGCTACTCAGAAGGTCTTAT pLKO_005 371 CDS 100% 13.200 6.600 Y Gm7452 n/a
10 TRCN0000095603 CCGTACCAACTCACTCAACAT pLKO.1 2089 CDS 100% 4.950 2.475 Y Zfp607b n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_009560.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.