Transcript: Mouse NM_009565.4

Mus musculus zinc finger and BTB domain containing 7B (Zbtb7b), mRNA.

Source:
NCBI, updated 2017-06-04
Taxon:
Mus musculus (mouse)
Gene:
Zbtb7b (22724)
Length:
3704
CDS:
176..1810

Additional Resources:

NCBI RefSeq record:
NM_009565.4
NBCI Gene record:
Zbtb7b (22724)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_009565.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000240693 GCAATAATCTATCTCTGATTT pLKO_005 2183 3UTR 100% 13.200 18.480 N Zbtb7b n/a
2 TRCN0000194510 GAGATAGCTATAGTCCTCCTA pLKO.1 939 CDS 100% 2.640 3.696 N Zbtb7b n/a
3 TRCN0000240696 GGACCAGTCCCTGTATCTATT pLKO_005 3402 3UTR 100% 13.200 9.240 N Zbtb7b n/a
4 TRCN0000240695 GTCTTGTTGAAATCCAATTTC pLKO_005 3123 3UTR 100% 13.200 9.240 N Zbtb7b n/a
5 TRCN0000240694 ATGCACCTCCATGCCCATTTG pLKO_005 3325 3UTR 100% 10.800 7.560 N Zbtb7b n/a
6 TRCN0000240692 CTGGGCCTCATCTTAGCATTT pLKO_005 3466 3UTR 100% 10.800 7.560 N Zbtb7b n/a
7 TRCN0000437332 GTGTGTGTGAGCTGGACTTTG pLKO_005 435 CDS 100% 10.800 7.560 N ZBTB7B n/a
8 TRCN0000193270 CTGAACTATGAAGTCTTTGAA pLKO.1 989 CDS 100% 5.625 3.938 N Zbtb7b n/a
9 TRCN0000431793 TCGCTGCTTGCATGGAGATTC pLKO_005 576 CDS 100% 10.800 6.480 N ZBTB7B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_009565.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08202 pDONR223 100% 86.8% 90.9% None (many diffs) n/a
2 ccsbBroad304_08202 pLX_304 0% 86.8% 90.9% V5 (many diffs) n/a
Download CSV