Transcript: Mouse NM_009570.4

Mus musculus zinc finger protein 1, Y-linked (Zfy1), mRNA.

Source:
NCBI, updated 2017-06-11
Taxon:
Mus musculus (mouse)
Gene:
Zfy1 (22767)
Length:
2785
CDS:
229..2577

Additional Resources:

NCBI RefSeq record:
NM_009570.4
NBCI Gene record:
Zfy1 (22767)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_009570.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000418675 ACTGCCAGTGCTCTCTTAAAC pLKO_005 1291 CDS 100% 13.200 10.560 N Zfy1 n/a
2 TRCN0000085320 GACCAGATTGTTGTGGAAGTA pLKO.1 316 CDS 100% 4.950 3.960 N Zfy1 n/a
3 TRCN0000434201 ATAATCCAGGCTCAGTTATAA pLKO_005 392 CDS 100% 15.000 10.500 N Zfy1 n/a
4 TRCN0000085318 GCATTGAGACAGTAAATTCAT pLKO.1 2607 3UTR 100% 5.625 3.938 N Zfy1 n/a
5 TRCN0000436543 ATGAATTAGGAGAAACTATAC pLKO_005 983 CDS 100% 10.800 6.480 N Zfy1 n/a
6 TRCN0000085322 CATCCTGAATACCTTGCTAAT pLKO.1 1501 CDS 100% 10.800 5.400 Y Zfy1 n/a
7 TRCN0000085319 GCAATATTTGTTGCTCCTGAT pLKO.1 1396 CDS 100% 4.050 2.025 Y Zfy1 n/a
8 TRCN0000085321 CCAAACAGTACCAGTCAGCAA pLKO.1 1379 CDS 100% 2.640 1.320 Y Zfy1 n/a
9 TRCN0000125371 CCATTTCTGCTTAGTCACCAT pLKO.1 2266 CDS 100% 2.640 1.320 Y Zfy2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_009570.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.