Transcript: Mouse NM_009631.4

Mus musculus adenosine A3 receptor (Adora3), mRNA.

Source:
NCBI, updated 2017-06-14
Taxon:
Mus musculus (mouse)
Gene:
Adora3 (11542)
Length:
2372
CDS:
380..1339

Additional Resources:

NCBI RefSeq record:
NM_009631.4
NBCI Gene record:
Adora3 (11542)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_009631.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000438020 GAGGACCACCACGTTCTATTT pLKO_005 511 CDS 100% 13.200 18.480 N Adora3 n/a
2 TRCN0000026252 GCAAGTCAAGATGCACTTCTA pLKO.1 604 CDS 100% 4.950 3.465 N Adora3 n/a
3 TRCN0000432472 TTCGCATGTGGTATCAGTAAA pLKO_005 1374 3UTR 100% 13.200 6.600 Y Adora3 n/a
4 TRCN0000435573 TTGAGCTTCTCTAATTCAATT pLKO_005 1527 3UTR 100% 13.200 6.600 Y Adora3 n/a
5 TRCN0000026272 CGTGGTCAGTTTGGATTACAT pLKO.1 892 CDS 100% 5.625 2.813 Y Adora3 n/a
6 TRCN0000026301 CCTATTGTCTACGCCTGCAAA pLKO.1 1217 CDS 100% 4.950 2.475 Y Adora3 n/a
7 TRCN0000026240 CCTCAGATTCTTTGGACTCAA pLKO.1 1296 CDS 100% 4.950 2.475 Y Adora3 n/a
8 TRCN0000026307 CCAGACAAAGAAGTAATGGAA pLKO.1 1609 3UTR 100% 3.000 1.500 Y Adora3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_009631.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.