Transcript: Mouse NM_009632.2

Mus musculus poly (ADP-ribose) polymerase family, member 2 (Parp2), mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Parp2 (11546)
Length:
1834
CDS:
3..1682

Additional Resources:

NCBI RefSeq record:
NM_009632.2
NBCI Gene record:
Parp2 (11546)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_009632.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000071216 CCGTATGCGATACCTTCTAAA pLKO.1 1631 CDS 100% 13.200 18.480 N Parp2 n/a
2 TRCN0000324994 CCGTATGCGATACCTTCTAAA pLKO_005 1631 CDS 100% 13.200 18.480 N Parp2 n/a
3 TRCN0000071215 GCGAGTGCTAAATGAAGCCAA pLKO.1 38 CDS 100% 2.640 2.112 N Parp2 n/a
4 TRCN0000324992 GCGAGTGCTAAATGAAGCCAA pLKO_005 38 CDS 100% 2.640 2.112 N Parp2 n/a
5 TRCN0000071217 CGGTTACCAGTCTCTCAAGAA pLKO.1 761 CDS 100% 4.950 3.465 N Parp2 n/a
6 TRCN0000325064 CGGTTACCAGTCTCTCAAGAA pLKO_005 761 CDS 100% 4.950 3.465 N Parp2 n/a
7 TRCN0000071214 GCTCCTACACACAAGGACTAT pLKO.1 1101 CDS 100% 4.950 3.465 N Parp2 n/a
8 TRCN0000325065 GCTCCTACACACAAGGACTAT pLKO_005 1101 CDS 100% 4.950 3.465 N Parp2 n/a
9 TRCN0000071213 TGTTGATCAGACAAGCCAGAG pLKO.1 1684 3UTR 100% 2.250 1.575 N Parp2 n/a
10 TRCN0000325067 TGTTGATCAGACAAGCCAGAG pLKO_005 1684 3UTR 100% 2.250 1.575 N Parp2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_009632.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.