Transcript: Mouse NM_009665.5

Mus musculus S-adenosylmethionine decarboxylase 1 (Amd1), mRNA.

Source:
NCBI, updated 2017-06-22
Taxon:
Mus musculus (mouse)
Gene:
Amd1 (11702)
Length:
3206
CDS:
331..1335

Additional Resources:

NCBI RefSeq record:
NM_009665.5
NBCI Gene record:
Amd1 (11702)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_009665.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000344760 GGTTTATGCACAGTGTAATAT pLKO_005 1649 3UTR 100% 15.000 7.500 Y AMD1 n/a
2 TRCN0000114860 GATGGAACATATTGGACTATT pLKO.1 1036 CDS 100% 13.200 6.600 Y Amd2 n/a
3 TRCN0000114853 CCCAGAAGATTGACGGCTTTA pLKO.1 1226 CDS 100% 10.800 5.400 Y Amd1 n/a
4 TRCN0000114852 GCCAGATCAAACACTGGAAAT pLKO.1 846 CDS 100% 10.800 5.400 Y Amd1 n/a
5 TRCN0000078462 GTCTCCAAGAGACGTTTCATT pLKO.1 544 CDS 100% 5.625 2.813 Y AMD1 n/a
6 TRCN0000363740 GTCTCCAAGAGACGTTTCATT pLKO_005 544 CDS 100% 5.625 2.813 Y AMD1 n/a
7 TRCN0000114858 CCTTGTTTGTTAATCAGAGTT pLKO.1 1178 CDS 100% 4.950 2.475 Y Amd2 n/a
8 TRCN0000114851 GCCTAGAACAACTGTAGGTAA pLKO.1 3039 3UTR 100% 4.950 2.475 Y Amd1 n/a
9 TRCN0000114855 GCTCAATCATAAGTGTGACAA pLKO.1 476 CDS 100% 4.950 2.475 Y Amd1 n/a
10 TRCN0000114854 CGGATGGAACATATTGGACTA pLKO.1 1034 CDS 100% 4.050 2.025 Y Amd1 n/a
11 TRCN0000114859 GCTAGGGATTACAGTGGGTTT pLKO.1 622 CDS 100% 4.050 2.025 Y Amd2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_009665.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.