Transcript: Mouse NM_009676.2

Mus musculus aldehyde oxidase 1 (Aox1), mRNA.

Source:
NCBI, updated 2017-05-14
Taxon:
Mus musculus (mouse)
Gene:
Aox1 (11761)
Length:
4382
CDS:
49..4050

Additional Resources:

NCBI RefSeq record:
NM_009676.2
NBCI Gene record:
Aox1 (11761)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_009676.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000271704 GAGCAGGTTCGAACCATAAAT pLKO_005 2875 CDS 100% 15.000 21.000 N Aox1 n/a
2 TRCN0000281823 TCTCTCGGCTGTTGGATATTT pLKO_005 3438 CDS 100% 15.000 21.000 N Aox1 n/a
3 TRCN0000281772 CACGTTGATACTACCCATTAC pLKO_005 2905 CDS 100% 10.800 15.120 N Aox1 n/a
4 TRCN0000281771 TCTGCTCTAAGATGCTAAATG pLKO_005 4111 3UTR 100% 13.200 10.560 N Aox1 n/a
5 TRCN0000271749 TTTCTGGGATGTTCGGTATTT pLKO_005 3853 CDS 100% 13.200 10.560 N Aox1 n/a
6 TRCN0000076571 CCCTTCGAATACTTTGTGTTT pLKO.1 3505 CDS 100% 4.950 3.960 N Aox1 n/a
7 TRCN0000076570 CCTGTGGGTATTGGATCAGTA pLKO.1 3076 CDS 100% 4.950 3.960 N Aox1 n/a
8 TRCN0000076572 GCTGTTTGGATCAAGAAATAA pLKO.1 581 CDS 100% 15.000 10.500 N Aox1 n/a
9 TRCN0000076568 CGGAAGATTCTCTTGAGGATA pLKO.1 4192 3UTR 100% 4.950 3.465 N Aox1 n/a
10 TRCN0000076569 GCCCATAATTGATGCCTGCAA pLKO.1 510 CDS 100% 2.640 1.848 N Aox1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_009676.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.