Transcript: Mouse NM_009680.3

Mus musculus adaptor-related protein complex 3, beta 1 subunit (Ap3b1), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Ap3b1 (11774)
Length:
4020
CDS:
145..3462

Additional Resources:

NCBI RefSeq record:
NM_009680.3
NBCI Gene record:
Ap3b1 (11774)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_009680.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000380965 TAAATCACTGGTGCGCTTATT pLKO_005 1155 CDS 100% 13.200 18.480 N Ap3b1 n/a
2 TRCN0000380402 TACGTTTACCTTGTCCGATAT pLKO_005 439 CDS 100% 10.800 15.120 N Ap3b1 n/a
3 TRCN0000100441 CGGTTCGCAATGTAGAAGTAA pLKO.1 2087 CDS 100% 5.625 7.875 N Ap3b1 n/a
4 TRCN0000100442 CCGGATAGAATCGATCTGATT pLKO.1 790 CDS 100% 4.950 6.930 N Ap3b1 n/a
5 TRCN0000100443 CCCGGATAGAATCGATCTGAT pLKO.1 789 CDS 100% 4.950 3.960 N Ap3b1 n/a
6 TRCN0000311174 TGGCTGTCGCTCAGCTATATT pLKO_005 1097 CDS 100% 15.000 10.500 N Ap3b1 n/a
7 TRCN0000311172 TGTCATGATGCTGGCTATTAA pLKO_005 591 CDS 100% 15.000 10.500 N Ap3b1 n/a
8 TRCN0000380055 ACAGATCACCCTGACTAATAC pLKO_005 2883 CDS 100% 13.200 9.240 N Ap3b1 n/a
9 TRCN0000304937 CAAGCATCCTTTGGCTAATTG pLKO_005 1637 CDS 100% 13.200 9.240 N Ap3b1 n/a
10 TRCN0000100444 GCTGTCCAACAGGGATGAAAT pLKO.1 1494 CDS 100% 13.200 9.240 N Ap3b1 n/a
11 TRCN0000375365 AGATCCACTGATCCAACTATG pLKO_005 1279 CDS 100% 10.800 7.560 N Ap3b1 n/a
12 TRCN0000100440 GCTTGGCAATCGTCCTTCTTA pLKO.1 3782 3UTR 100% 5.625 3.938 N Ap3b1 n/a
13 TRCN0000302757 GCTTGGCAATCGTCCTTCTTA pLKO_005 3782 3UTR 100% 5.625 3.938 N Ap3b1 n/a
14 TRCN0000065058 CCTCTCAGCTTGGTATGTGAA pLKO.1 3843 3UTR 100% 4.950 3.465 N AP3B1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_009680.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.