Transcript: Mouse NM_009702.3

Mus musculus aquarius (Aqr), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-02-24
Taxon:
Mus musculus (mouse)
Gene:
Aqr (11834)
Length:
4897
CDS:
174..4619

Additional Resources:

NCBI RefSeq record:
NM_009702.3
NBCI Gene record:
Aqr (11834)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_009702.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000123834 GCCTGGGACATTCCATTTATA pLKO.1 4635 3UTR 100% 15.000 21.000 N Aqr n/a
2 TRCN0000327191 GCCTGGGACATTCCATTTATA pLKO_005 4635 3UTR 100% 15.000 21.000 N Aqr n/a
3 TRCN0000123835 GCCGATTGAAACGGTGGATTA pLKO.1 3442 CDS 100% 10.800 15.120 N Aqr n/a
4 TRCN0000327190 GCCGATTGAAACGGTGGATTA pLKO_005 3442 CDS 100% 10.800 15.120 N Aqr n/a
5 TRCN0000123838 CCACTGCATTTGCATATCATT pLKO.1 4164 CDS 100% 5.625 3.938 N Aqr n/a
6 TRCN0000327314 CCACTGCATTTGCATATCATT pLKO_005 4164 CDS 100% 5.625 3.938 N Aqr n/a
7 TRCN0000123836 GCAGACAAGATCAGTATTCTA pLKO.1 3846 CDS 100% 5.625 3.938 N Aqr n/a
8 TRCN0000327192 GCAGACAAGATCAGTATTCTA pLKO_005 3846 CDS 100% 5.625 3.938 N Aqr n/a
9 TRCN0000123837 GCCTACCAAGAAAGAAGGTTT pLKO.1 816 CDS 100% 4.950 3.465 N Aqr n/a
10 TRCN0000327264 GCCTACCAAGAAAGAAGGTTT pLKO_005 816 CDS 100% 4.950 3.465 N Aqr n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_009702.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.