Transcript: Mouse NM_009735.3

Mus musculus beta-2 microglobulin (B2m), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
B2m (12010)
Length:
858
CDS:
52..411

Additional Resources:

NCBI RefSeq record:
NM_009735.3
NBCI Gene record:
B2m (12010)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_009735.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000380100 AGAGTTAAGCATGCCAGTATG pLKO_005 352 CDS 100% 10.800 15.120 N B2m n/a
2 TRCN0000066427 CGGCCTGTATGCTATCCAGAA pLKO.1 99 CDS 100% 4.050 5.670 N B2m n/a
3 TRCN0000295705 CCAGTTTCTAATATGCTATAC pLKO_005 463 3UTR 100% 10.800 8.640 N B2m n/a
4 TRCN0000295762 TAAAGTAGAGATGTCAGATAT pLKO_005 252 CDS 100% 13.200 9.240 N B2m n/a
5 TRCN0000295765 CCCACTGAGACTGATACATAC pLKO_005 325 CDS 100% 10.800 7.560 N B2m n/a
6 TRCN0000295704 TTCAGCAAGGACTGGTCTTTC pLKO_005 277 CDS 100% 10.800 7.560 N B2m n/a
7 TRCN0000066423 CGCCTCACATTGAAATCCAAA pLKO.1 206 CDS 100% 4.950 3.465 N B2m n/a
8 TRCN0000381475 CGTCTACTGGGATCGAGACAT pLKO_005 387 CDS 100% 4.950 3.465 N B2m n/a
9 TRCN0000066425 GCAGAGTTAAGCATGCCAGTA pLKO.1 350 CDS 100% 4.050 2.835 N B2m n/a
10 TRCN0000066424 GCCGAACATACTGAACTGCTA pLKO.1 168 CDS 100% 2.640 1.848 N B2m n/a
11 TRCN0000288438 GCCGAACATACTGAACTGCTA pLKO_005 168 CDS 100% 2.640 1.848 N B2m n/a
12 TRCN0000066426 CCAAATGCTGAAGAACGGGAA pLKO.1 222 CDS 100% 2.160 1.512 N B2m n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_009735.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.