Transcript: Mouse NM_009764.3

Mus musculus breast cancer 1, early onset (Brca1), mRNA.

Source:
NCBI, updated 2017-06-14
Taxon:
Mus musculus (mouse)
Gene:
Brca1 (12189)
Length:
6648
CDS:
207..5645

Additional Resources:

NCBI RefSeq record:
NM_009764.3
NBCI Gene record:
Brca1 (12189)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_009764.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000042560 CCCATCATACTTTAATGTGTA pLKO.1 1504 CDS 100% 4.950 6.930 N Brca1 n/a
2 TRCN0000042562 CCACAGGTAAATCAGGAATTT pLKO.1 3055 CDS 100% 13.200 10.560 N Brca1 n/a
3 TRCN0000326124 CCACAGGTAAATCAGGAATTT pLKO_005 3055 CDS 100% 13.200 10.560 N Brca1 n/a
4 TRCN0000376030 CCAAGAAGAGGATAGTATAAT pLKO_005 4157 CDS 100% 15.000 10.500 N Brca1 n/a
5 TRCN0000306222 GTGCTTCCACACCCTACTTAC pLKO_005 5692 3UTR 100% 10.800 7.560 N Brca1 n/a
6 TRCN0000042561 CCTTTGTGTAAGAATGAGATA pLKO.1 390 CDS 100% 4.950 3.465 N Brca1 n/a
7 TRCN0000326197 CCTTTGTGTAAGAATGAGATA pLKO_005 390 CDS 100% 4.950 3.465 N Brca1 n/a
8 TRCN0000042559 GCTCAGTGTATGACTCAGTTT pLKO.1 2577 CDS 100% 4.950 3.465 N Brca1 n/a
9 TRCN0000326125 GCTCAGTGTATGACTCAGTTT pLKO_005 2577 CDS 100% 4.950 3.465 N Brca1 n/a
10 TRCN0000042558 CCTCACTTTAACTGACGCAAT pLKO.1 5054 CDS 100% 4.050 2.835 N Brca1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_009764.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.