Transcript: Mouse NM_009786.2

Mus musculus calcyclin binding protein (Cacybp), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Cacybp (12301)
Length:
2115
CDS:
226..915

Additional Resources:

NCBI RefSeq record:
NM_009786.2
NBCI Gene record:
Cacybp (12301)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_009786.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000125175 CGATGATATGAAGCGAACCAT pLKO.1 837 CDS 100% 3.000 4.200 N Cacybp n/a
2 TRCN0000148456 CGATGATATGAAGCGAACCAT pLKO.1 837 CDS 100% 3.000 4.200 N CACYBP n/a
3 TRCN0000363649 CGATGATATGAAGCGAACCAT pLKO_005 837 CDS 100% 3.000 4.200 N Cacybp n/a
4 TRCN0000363650 CGATGATATGAAGCGAACCAT pLKO_005 837 CDS 100% 3.000 4.200 N CACYBP n/a
5 TRCN0000125177 CAAGATTGAGACGGAACTCAA pLKO.1 333 CDS 100% 0.495 0.693 N Cacybp n/a
6 TRCN0000311946 CAAGATTGAGACGGAACTCAA pLKO_005 333 CDS 100% 0.495 0.693 N Cacybp n/a
7 TRCN0000146815 CAAGAACAAGATGCAACAGAA pLKO.1 351 CDS 100% 4.950 3.465 N CACYBP n/a
8 TRCN0000292260 CAAGAACAAGATGCAACAGAA pLKO_005 351 CDS 100% 4.950 3.465 N CACYBP n/a
9 TRCN0000125178 CAGTCAGATAAGTTTGTGAAA pLKO.1 472 CDS 100% 4.950 3.465 N Cacybp n/a
10 TRCN0000312018 CAGTCAGATAAGTTTGTGAAA pLKO_005 472 CDS 100% 4.950 3.465 N Cacybp n/a
11 TRCN0000125174 CCCAGACATTTCGTTTCAGAA pLKO.1 1131 3UTR 100% 4.950 3.465 N Cacybp n/a
12 TRCN0000312019 CCCAGACATTTCGTTTCAGAA pLKO_005 1131 3UTR 100% 4.950 3.465 N Cacybp n/a
13 TRCN0000125176 GCAACAGAAGTCGCAGAAGAA pLKO.1 363 CDS 100% 4.950 3.465 N Cacybp n/a
14 TRCN0000311947 GCAACAGAAGTCGCAGAAGAA pLKO_005 363 CDS 100% 4.950 3.465 N Cacybp n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_009786.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.