Transcript: Mouse NM_009832.2

Mus musculus cyclin K (Ccnk), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Ccnk (12454)
Length:
2632
CDS:
226..1974

Additional Resources:

NCBI RefSeq record:
NM_009832.2
NBCI Gene record:
Ccnk (12454)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_009832.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000077807 GCGGGACGTTTGTGCAAATTT pLKO.1 865 CDS 100% 15.000 21.000 N Ccnk n/a
2 TRCN0000077806 CAGACCATAAAGTTTGACTTA pLKO.1 670 CDS 100% 4.950 3.465 N Ccnk n/a
3 TRCN0000077805 GCAGACCATAAAGTTTGACTT pLKO.1 669 CDS 100% 4.950 3.465 N Ccnk n/a
4 TRCN0000077803 GCTCAGTTAATAGCTTCAGTA pLKO.1 2218 3UTR 100% 4.950 3.465 N Ccnk n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_009832.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14004 pDONR223 100% 55.3% 53.1% None (many diffs) n/a
2 ccsbBroad304_14004 pLX_304 0% 55.3% 53.1% V5 (not translated due to frame shift) (many diffs) n/a
Download CSV