Transcript: Mouse NM_009949.2

Mus musculus carnitine palmitoyltransferase 2 (Cpt2), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Cpt2 (12896)
Length:
2366
CDS:
124..2100

Additional Resources:

NCBI RefSeq record:
NM_009949.2
NBCI Gene record:
Cpt2 (12896)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_009949.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000313238 CCCTGCATACCAGCGGATAAA pLKO_005 1851 CDS 100% 13.200 18.480 N Cpt2 n/a
2 TRCN0000110503 CCTGGATATGTCCCAATATTT pLKO.1 756 CDS 100% 15.000 12.000 N Cpt2 n/a
3 TRCN0000313237 GACCCGAAGTCTGAGTATAAT pLKO_005 541 CDS 100% 15.000 12.000 N Cpt2 n/a
4 TRCN0000313235 CATTCTTCCTCATGAACATTG pLKO_005 2124 3UTR 100% 10.800 7.560 N Cpt2 n/a
5 TRCN0000110501 GCTGGTTTGATAAGTCCTTTA pLKO.1 1172 CDS 100% 10.800 7.560 N Cpt2 n/a
6 TRCN0000312184 GCTGGTTTGATAAGTCCTTTA pLKO_005 1172 CDS 100% 10.800 7.560 N Cpt2 n/a
7 TRCN0000313236 TGGCTTTCCTGCGACAGTATG pLKO_005 1541 CDS 100% 10.800 7.560 N Cpt2 n/a
8 TRCN0000110502 CCAGCGGATAAACCACAACAT pLKO.1 1860 CDS 100% 4.950 3.465 N Cpt2 n/a
9 TRCN0000110504 GCTGTTCACGATGACTGGATA pLKO.1 1966 CDS 100% 4.950 3.465 N Cpt2 n/a
10 TRCN0000003089 CCAGGGCTTTGACCGACACTT pLKO.1 1770 CDS 100% 1.650 1.155 N CPT2 n/a
11 TRCN0000110500 GCCTCCATTCTTCCTCATGAA pLKO.1 2119 3UTR 100% 4.950 2.970 N Cpt2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_009949.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.