Transcript: Mouse NM_009977.3

Mus musculus cystatin F (leukocystatin) (Cst7), mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Cst7 (13011)
Length:
986
CDS:
105..539

Additional Resources:

NCBI RefSeq record:
NM_009977.3
NBCI Gene record:
Cst7 (13011)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_009977.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000067234 CGGACTCTATATTGCTACTCT pLKO.1 459 CDS 100% 3.000 4.200 N Cst7 n/a
2 TRCN0000067236 CACTACATGCTCCCTGCATTT pLKO.1 76 5UTR 100% 10.800 7.560 N Cst7 n/a
3 TRCN0000067233 CCAACTGGACAACTGTGACTT pLKO.1 416 CDS 100% 4.950 3.465 N Cst7 n/a
4 TRCN0000067237 CCTGAAATATATGCTGGAGGT pLKO.1 356 CDS 100% 2.160 1.512 N Cst7 n/a
5 TRCN0000067235 GCCCTGGTACAGGTGGTGAAA pLKO.1 333 CDS 100% 1.650 1.155 N Cst7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_009977.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.